pcr-script amp cloning kit (Agilent technologies)
Agilent technologies is a verified supplier 
Agilent technologies manufactures this product 
90
Structured Review
Agilent technologies
pcr-script amp cloning kit
Pcr Script Amp Cloning Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr-script+amp+cloning+kit/pmc03895837-55-33-37
Average 90 stars, based on 1 article reviews
Pcr Script Amp Cloning Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr-script+amp+cloning+kit/pmc03895837-55-33-37
Average 90 stars, based on 1 article reviews
pcr-script amp cloning kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Fluorescence:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Polymerase Chain Reaction:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Clone Assay:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Plasmid Preparation:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Transformation Assay:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Reverse Transcription Polymerase Chain Reaction:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with TA Cloning:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Sequencing:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Amplification:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with Isolation:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with DNA Sequencing:Article Title: Multiaptamer target detection Article Snippet: Aptamer pools obtained in SELEX were cloned using the Article Title: Macromolecular compositions that cross the blood-brain barrier and methods of use thereof Article Snippet: The VH and VL bands were isolated from the agarose gels and subcloned into the pPCR-Script to form pPC-mAβ-VH and pPC-mAβ-VL (FIG. 1A) using the Article Title: SNP discovery by high-throughput sequencing in soybean Article Snippet: Before submitting to Illumina for sequencing, the quality of the library was determined by cloning a portion of DNA fragments into the pPCR-Script Amp SK(+) Cloning Vector provided in the Article Title: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery Article Snippet: After the selected pool showed significantly higher fluorescence signals than the unselected one (see Additional file : Figure S1), selected pool was PCR-amplified using unlabeled primers, cloned into pPCR-Script Amp SK(+) vector with Article Title: The genus Prototheca (Trebouxiophyceae, Chlorophyta) revisited: Implications from molecular taxonomic studies Article Snippet: The only algae which are able to inflict disease on humans and other mammals through active invasion and spread within the host tissues belong to either of two genera: Chlorella and Prototheca.. Whereas Chlorella infections are extremely rare, with only two human cases reported in the literature, protothecosis is an emerging disease of humans and domestic animals, especially dairy cows.. The genus Prototheca, erected by Krüger in 1894, has undergone several significant revisions, as more phenotypic, chemotaxonomic, and molecular data have become available. Article Title: ALDH1A2 (RALDH2) genetic variation in human congenital heart disease Article Snippet: The amplified fragments were then cloned into the Article Title: Extracellular matrix-specific Caveolin-1 phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not tumorigenesis Article Snippet: The Article Title: Hind limb unloading of mice modulates gene expression at the protein and mRNA level in mesenchymal bone cells Article Snippet: Stetler-Stevenson: VEGF-A, 700 bp cDNA cloned by RT-PCR with the PCR TA cloning kit (Invitrogen, USA) from human total RNA in PCR 2.1 vector (primers for human VEGF-A: Lp CCTTGCTGCTCTACCTCCAC Rp TCTGTCGATGGTGATGGTGT, recognizing all VEGF-A mRNA splicing variants); CXCR4 (NM_009911) 692 bp cDNA cloned by RT-PCR with |